fap α Search Results


human fibroblast activation protein alpha/fap pe-conjugated antibody  (Bio-Techne corporation)
94
Bio-Techne corporation human fibroblast activation protein alpha/fap pe-conjugated antibody
Human Fibroblast Activation Protein Alpha/Fap Pe Conjugated Antibody, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human fibroblast activation protein alpha/fap pe-conjugated antibody/product/Bio-Techne corporation
Average 94 stars, based on 1 article reviews
human fibroblast activation protein alpha/fap pe-conjugated antibody - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier
human fapalpha biorad ahp1322 rb linker  (Bio-Rad)
91
Bio-Rad human fapalpha biorad ahp1322 rb linker
Human Fapalpha Biorad Ahp1322 Rb Linker, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human fapalpha biorad ahp1322 rb linker/product/Bio-Rad
Average 91 stars, based on 1 article reviews
human fapalpha biorad ahp1322 rb linker - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier
sinusoidal microsystem targeting fap-α and epcam for ctcs phenotyping  (BioFluidica Inc)
90
BioFluidica Inc sinusoidal microsystem targeting fap-α and epcam for ctcs phenotyping
Sinusoidal Microsystem Targeting Fap α And Epcam For Ctcs Phenotyping, supplied by BioFluidica Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sinusoidal microsystem targeting fap-α and epcam for ctcs phenotyping/product/BioFluidica Inc
Average 90 stars, based on 1 article reviews
sinusoidal microsystem targeting fap-α and epcam for ctcs phenotyping - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
fap-alpha rabbit pab  (Affinity Biosciences)
90
Affinity Biosciences fap-alpha rabbit pab
Fap Alpha Rabbit Pab, supplied by Affinity Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fap-alpha rabbit pab/product/Affinity Biosciences
Average 90 stars, based on 1 article reviews
fap-alpha rabbit pab - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
fap α (14 ng/well)  (Proteros Biostructures)
90
Proteros Biostructures fap α (14 ng/well)
Fap α (14 Ng/Well), supplied by Proteros Biostructures, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fap α (14 ng/well)/product/Proteros Biostructures
Average 90 stars, based on 1 article reviews
fap α (14 ng/well) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
monoclonal antibody that binds to fap-α  (Boehringer Ingelheim)
90
Boehringer Ingelheim monoclonal antibody that binds to fap-α
Monoclonal Antibody That Binds To Fap α, supplied by Boehringer Ingelheim, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/monoclonal antibody that binds to fap-α/product/Boehringer Ingelheim
Average 90 stars, based on 1 article reviews
monoclonal antibody that binds to fap-α - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
anti-fap/anti-cd3 bispecific t-cell activator  (PsiOxus Therapeutics)
90
PsiOxus Therapeutics anti-fap/anti-cd3 bispecific t-cell activator
Adenoviral vectors currently in clinical trials for cancer therapy. Replication defective viruses that are used for gene delivery only are shaded in grey.
Anti Fap/Anti Cd3 Bispecific T Cell Activator, supplied by PsiOxus Therapeutics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-fap/anti-cd3 bispecific t-cell activator/product/PsiOxus Therapeutics
Average 90 stars, based on 1 article reviews
anti-fap/anti-cd3 bispecific t-cell activator - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
fap-α sirna (cggaatttaatgatacggata)  (Qiagen)
90
Qiagen fap-α sirna (cggaatttaatgatacggata)
Adenoviral vectors currently in clinical trials for cancer therapy. Replication defective viruses that are used for gene delivery only are shaded in grey.
Fap α Sirna (Cggaatttaatgatacggata), supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fap-α sirna (cggaatttaatgatacggata)/product/Qiagen
Average 90 stars, based on 1 article reviews
fap-α sirna (cggaatttaatgatacggata) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
humanised anti-fap-alpha (fibroblast activating protein) scfv (f19)  (Boehringer Ingelheim)
90
Boehringer Ingelheim humanised anti-fap-alpha (fibroblast activating protein) scfv (f19)
Adenoviral vectors currently in clinical trials for cancer therapy. Replication defective viruses that are used for gene delivery only are shaded in grey.
Humanised Anti Fap Alpha (Fibroblast Activating Protein) Scfv (F19), supplied by Boehringer Ingelheim, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/humanised anti-fap-alpha (fibroblast activating protein) scfv (f19)/product/Boehringer Ingelheim
Average 90 stars, based on 1 article reviews
humanised anti-fap-alpha (fibroblast activating protein) scfv (f19) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
fap-α peptide  (Bankpeptide biological technology co LTD)
90
Bankpeptide biological technology co LTD fap-α peptide
Adenoviral vectors currently in clinical trials for cancer therapy. Replication defective viruses that are used for gene delivery only are shaded in grey.
Fap α Peptide, supplied by Bankpeptide biological technology co LTD, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fap-α peptide/product/Bankpeptide biological technology co LTD
Average 90 stars, based on 1 article reviews
fap-α peptide - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
fap-alpha sensitive nanotherapeutics cap-dox  (Nanotherapeutics)
90
Nanotherapeutics fap-alpha sensitive nanotherapeutics cap-dox
Adenoviral vectors currently in clinical trials for cancer therapy. Replication defective viruses that are used for gene delivery only are shaded in grey.
Fap Alpha Sensitive Nanotherapeutics Cap Dox, supplied by Nanotherapeutics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fap-alpha sensitive nanotherapeutics cap-dox/product/Nanotherapeutics
Average 90 stars, based on 1 article reviews
fap-alpha sensitive nanotherapeutics cap-dox - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
fap-α rabbit polyclonal antibody  (Beijing Solarbio Science)
90
Beijing Solarbio Science fap-α rabbit polyclonal antibody
Adenoviral vectors currently in clinical trials for cancer therapy. Replication defective viruses that are used for gene delivery only are shaded in grey.
Fap α Rabbit Polyclonal Antibody, supplied by Beijing Solarbio Science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fap-α rabbit polyclonal antibody/product/Beijing Solarbio Science
Average 90 stars, based on 1 article reviews
fap-α rabbit polyclonal antibody - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Adenoviral vectors currently in clinical trials for cancer therapy. Replication defective viruses that are used for gene delivery only are shaded in grey.

Journal: Viruses

Article Title: A Renaissance for Oncolytic Adenoviruses?

doi: 10.3390/v15020358

Figure Lengend Snippet: Adenoviral vectors currently in clinical trials for cancer therapy. Replication defective viruses that are used for gene delivery only are shaded in grey.

Article Snippet: NG-641 , Ad11/Ad3 chimera , untouched (Ad11) , Ad11 , secreted Interferon alpha, the chemokines CXCL9, CXCL10 and an anti-FAP/anti-CD3 bispecific T-cell activator , near complete deletion , , PsiOxus Therapeutics.

Techniques: Modification, Plasmid Preparation, Mutagenesis